Review

anti tlr monoclonal antibodies mab t2 5 (InvivoGen)

Name: anti tlr monoclonal antibodies mab t2 5
Brand: InvivoGen
Rating: 86 (1 reviews)

InvivoGen is a verified supplier

InvivoGen manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

InvivoGen anti tlr monoclonal antibodies mab t2 5

Effect of specific <t>TLR2,</t> 4, and 7/8 agonist stimulation or of bacterial immune stimulation with and without TLR blockade: dose finding studies for TLR blockade. Supernatant TNF and IL-6 concentrations measured by ELISA after 6 h of incubation of whole blood from healthy volunteers following stimulation with TLR2, 4, or 7/8 agonists or with heat-killed bacteria with and without antibodies directed against TLR2, TLR4, or with chloroquine. Concentrations as indicated. (A) Effects of the TLR2 agonist P 3 C. (B) Addition of anti-TLR2 <t>mAb</t> <t>T2.5</t> 30 min prior to the addition of the TLR2 agonist P 3 C (10 µg/ml). (C) Effects of the TLR4 agonist LPS : Re595. (D) Addition of anti-TLR4 mAb 3C3 30 min prior to addition of TLR4 agonist LPS : Re595 (0.1 µg/ml). (E) Effects of the endosomal inhibitor chloroquine (CQ) 30 min prior to the addition of TLR7/8 agonist Resiquimod (R848). (F) Addition of the endosomal inhibitor chloroquine (CQ) 30 min prior to addition of the TLR-independent immune stimuli phorbol-12-myristate-13-acetate and Ionomycin (PMA+I) as a toxicity control for CQ; low dose of PMA+I is 0.2 + 0.14 µg/ml, high dose is 1 + 0.7 µg/ml. (G) Addition of the endosomal inhibitor chloroquine (CQ) 30 min prior to the addition of heat-killed S. aureus or E . coli . n.d., not detected. Measurements from 2-3 individuals each. (A–F) single-point graph with means, (G) means with standard deviation.

Anti Tlr Monoclonal Antibodies Mab T2 5, supplied by InvivoGen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti tlr monoclonal antibodies mab t2 5/product/InvivoGen
Average 86 stars, based on 1 article reviews

anti tlr monoclonal antibodies mab t2 5 - by Bioz Stars, 2026-02

86/100 stars

Images

1) Product Images from "Substantial heterogeneity of inflammatory cytokine production and its inhibition by a triple cocktail of toll-like receptor blockers in early sepsis"

Article Title: Substantial heterogeneity of inflammatory cytokine production and its inhibition by a triple cocktail of toll-like receptor blockers in early sepsis

Journal: Frontiers in Immunology

doi: 10.3389/fimmu.2023.1277033

Effect of specific TLR2, 4, and 7/8 agonist stimulation or of bacterial immune stimulation with and without TLR blockade: dose finding studies for TLR blockade. Supernatant TNF and IL-6 concentrations measured by ELISA after 6 h of incubation of whole blood from healthy volunteers following stimulation with TLR2, 4, or 7/8 agonists or with heat-killed bacteria with and without antibodies directed against TLR2, TLR4, or with chloroquine. Concentrations as indicated. (A) Effects of the TLR2 agonist P 3 C. (B) Addition of anti-TLR2 mAb T2.5 30 min prior to the addition of the TLR2 agonist P 3 C (10 µg/ml). (C) Effects of the TLR4 agonist LPS : Re595. (D) Addition of anti-TLR4 mAb 3C3 30 min prior to addition of TLR4 agonist LPS : Re595 (0.1 µg/ml). (E) Effects of the endosomal inhibitor chloroquine (CQ) 30 min prior to the addition of TLR7/8 agonist Resiquimod (R848). (F) Addition of the endosomal inhibitor chloroquine (CQ) 30 min prior to addition of the TLR-independent immune stimuli phorbol-12-myristate-13-acetate and Ionomycin (PMA+I) as a toxicity control for CQ; low dose of PMA+I is 0.2 + 0.14 µg/ml, high dose is 1 + 0.7 µg/ml. (G) Addition of the endosomal inhibitor chloroquine (CQ) 30 min prior to the addition of heat-killed S. aureus or E . coli . n.d., not detected. Measurements from 2-3 individuals each. (A–F) single-point graph with means, (G) means with standard deviation.

Figure Legend Snippet: Effect of specific TLR2, 4, and 7/8 agonist stimulation or of bacterial immune stimulation with and without TLR blockade: dose finding studies for TLR blockade. Supernatant TNF and IL-6 concentrations measured by ELISA after 6 h of incubation of whole blood from healthy volunteers following stimulation with TLR2, 4, or 7/8 agonists or with heat-killed bacteria with and without antibodies directed against TLR2, TLR4, or with chloroquine. Concentrations as indicated. (A) Effects of the TLR2 agonist P 3 C. (B) Addition of anti-TLR2 mAb T2.5 30 min prior to the addition of the TLR2 agonist P 3 C (10 µg/ml). (C) Effects of the TLR4 agonist LPS : Re595. (D) Addition of anti-TLR4 mAb 3C3 30 min prior to addition of TLR4 agonist LPS : Re595 (0.1 µg/ml). (E) Effects of the endosomal inhibitor chloroquine (CQ) 30 min prior to the addition of TLR7/8 agonist Resiquimod (R848). (F) Addition of the endosomal inhibitor chloroquine (CQ) 30 min prior to addition of the TLR-independent immune stimuli phorbol-12-myristate-13-acetate and Ionomycin (PMA+I) as a toxicity control for CQ; low dose of PMA+I is 0.2 + 0.14 µg/ml, high dose is 1 + 0.7 µg/ml. (G) Addition of the endosomal inhibitor chloroquine (CQ) 30 min prior to the addition of heat-killed S. aureus or E . coli . n.d., not detected. Measurements from 2-3 individuals each. (A–F) single-point graph with means, (G) means with standard deviation.

Techniques Used: Enzyme-linked Immunosorbent Assay, Incubation, Bacteria, Standard Deviation

Inhibition of supernatant inflammatory cytokine production by triple Toll-like receptor blockade upon bacterial stimulation in whole blood assays. Cytokine supernatant concentrations (ELISA) before and after incubation for 6 h of whole blood without or with heat-killed E. coli (10 5 cfu/ml; E.c.) or S. aureus bacteria (10 6 cfu/ml; S.a.) and without or with TLR blockade by 15 µg/ml monoclonal antibodies T2.5 and 3C3 directed against TLR2 (anti TLR2) and TLR4 (anti TLR4), or with 10 µg/ml chloroquine (CQ), or with a triple combination (TLR-I) when added 30 min prior to addition of bacterial stimuli. (A) Healthy volunteers (n=3). Single-point graph with means. Student’s t-test for paired samples. (B) Sepsis patients sampled within 24 h of sepsis diagnosis (n=10), multiplex (Luminex) ELISA. Tukey Boxplots. Wilcoxon matched pairs test. n.d., not detected. *one data point out of axis limits. Inc, Incubation for 6 h; Bac, added Bacteria. A combined blockade of TLR2, 4, and endosomal TLRs effectively suppresses bacteria-stimulated inflammatory cytokine production in whole blood assays both from healthy volunteers and sepsis patients.

Figure Legend Snippet: Inhibition of supernatant inflammatory cytokine production by triple Toll-like receptor blockade upon bacterial stimulation in whole blood assays. Cytokine supernatant concentrations (ELISA) before and after incubation for 6 h of whole blood without or with heat-killed E. coli (10 5 cfu/ml; E.c.) or S. aureus bacteria (10 6 cfu/ml; S.a.) and without or with TLR blockade by 15 µg/ml monoclonal antibodies T2.5 and 3C3 directed against TLR2 (anti TLR2) and TLR4 (anti TLR4), or with 10 µg/ml chloroquine (CQ), or with a triple combination (TLR-I) when added 30 min prior to addition of bacterial stimuli. (A) Healthy volunteers (n=3). Single-point graph with means. Student’s t-test for paired samples. (B) Sepsis patients sampled within 24 h of sepsis diagnosis (n=10), multiplex (Luminex) ELISA. Tukey Boxplots. Wilcoxon matched pairs test. n.d., not detected. *one data point out of axis limits. Inc, Incubation for 6 h; Bac, added Bacteria. A combined blockade of TLR2, 4, and endosomal TLRs effectively suppresses bacteria-stimulated inflammatory cytokine production in whole blood assays both from healthy volunteers and sepsis patients.

Techniques Used: Inhibition, Enzyme-linked Immunosorbent Assay, Incubation, Bacteria, Multiplex Assay, Luminex

Robust TLR-dependent inflammation only in approximately a quarter of sepsis patients. (A) Supernatant inflammatory cytokine concentrations (multiplex ELISA) before and after a 6 h incubation (“Incubation”) of whole blood from sepsis patients (n=51, shaded columns) and healthy volunteers (n=11, open columns) with or without a triple combination of TLR inhibitors (“Triple TLR-I”; anti-TLR2 mAb T2.5, anti-TLR4 mAb 3C3 (both 15 µg/ml), chloroquine 10 µg/ml). Tukey boxplots. Mann-Whitney test for unpaired and Wilcoxon matched-pairs test for paired data sets. *one data point out of axis limits. (B) Patient samples sorted by their values for intrinsic ex vivo production of IL-6, TNF, IL-10, IL-1α or β over 6 hours (ΔIncubation). Shown are the quartile-medians of ΔIncubation and the paired TLR-I effect (sorted after ΔIncubation). Values from 51 sepsis patients sorted into 4 quartiles.

Figure Legend Snippet: Robust TLR-dependent inflammation only in approximately a quarter of sepsis patients. (A) Supernatant inflammatory cytokine concentrations (multiplex ELISA) before and after a 6 h incubation (“Incubation”) of whole blood from sepsis patients (n=51, shaded columns) and healthy volunteers (n=11, open columns) with or without a triple combination of TLR inhibitors (“Triple TLR-I”; anti-TLR2 mAb T2.5, anti-TLR4 mAb 3C3 (both 15 µg/ml), chloroquine 10 µg/ml). Tukey boxplots. Mann-Whitney test for unpaired and Wilcoxon matched-pairs test for paired data sets. *one data point out of axis limits. (B) Patient samples sorted by their values for intrinsic ex vivo production of IL-6, TNF, IL-10, IL-1α or β over 6 hours (ΔIncubation). Shown are the quartile-medians of ΔIncubation and the paired TLR-I effect (sorted after ΔIncubation). Values from 51 sepsis patients sorted into 4 quartiles.

Techniques Used: Multiplex Assay, Enzyme-linked Immunosorbent Assay, Incubation, MANN-WHITNEY, Ex Vivo

The effect of a combined TLR-blockade is positively correlated with the intrinsic cytokine production ex vivo . (A) Supernatant inflammatory cytokine concentrations before and after a 6 h incubation of whole blood of sepsis patients (shaded columns) showing the greatest ex vivo production (ΔIncubation) of each cytokine after incubation for 6 h (quartile 4 of ΔIncubation) and of healthy volunteers (n=11, open columns) with or without a cocktail of TLR inhibitors (anti-TLR2 mAb T2.5, anti-TLR4 mAb 3C3 (both 15 µg/ml), and chloroquine 10 µg/ml). Data from quartile 4 (n=13 patients). Tukey boxplots. Mann-Whitney test for unpaired and Wilcoxon matched-pairs test for paired data sets. *one datapoint out of axis limits. (B) Plot and Spearman’s rank correlation of concentration changes over 6 hours of incubation (ΔIncubation) alone and with added TLR-inhibitors (TLR-I effect). n=51 patients. Negative values cannot be plotted on the logarithmic axes but are included in the analysis. Combined TLR-inhibition strongly inhibits cytokine production in those samples with a high intrinsic cytokine production. Intrinsic cytokine production and TLR-I effect correlate significantly.

Figure Legend Snippet: The effect of a combined TLR-blockade is positively correlated with the intrinsic cytokine production ex vivo . (A) Supernatant inflammatory cytokine concentrations before and after a 6 h incubation of whole blood of sepsis patients (shaded columns) showing the greatest ex vivo production (ΔIncubation) of each cytokine after incubation for 6 h (quartile 4 of ΔIncubation) and of healthy volunteers (n=11, open columns) with or without a cocktail of TLR inhibitors (anti-TLR2 mAb T2.5, anti-TLR4 mAb 3C3 (both 15 µg/ml), and chloroquine 10 µg/ml). Data from quartile 4 (n=13 patients). Tukey boxplots. Mann-Whitney test for unpaired and Wilcoxon matched-pairs test for paired data sets. *one datapoint out of axis limits. (B) Plot and Spearman’s rank correlation of concentration changes over 6 hours of incubation (ΔIncubation) alone and with added TLR-inhibitors (TLR-I effect). n=51 patients. Negative values cannot be plotted on the logarithmic axes but are included in the analysis. Combined TLR-inhibition strongly inhibits cytokine production in those samples with a high intrinsic cytokine production. Intrinsic cytokine production and TLR-I effect correlate significantly.

Techniques Used: Ex Vivo, Incubation, MANN-WHITNEY, Concentration Assay, Inhibition

Effects of triple TLR-blockade are correlated with and predicted by baseline IL-6 and TNF concentrations in host plasma. (A) Plot and Spearman’s rank correlations of baseline TNF and IL-6 concentrations in host plasma with the effect of triple toll-like receptor inhibition (TLR-I) on cytokine concentration changes over incubation ex vivo (expressed as difference in respective concentrations without and with triple inhibition by TLR2, 4, and endosomal TLRs). (B) Receiver operating characteristics (ROC), area under the curve (AUC), respective confidence intervals and p-values (regarding the null-hypothesis of AUC=0.5) of the prediction of a strong reaction to TLR-I ( i.e. , of a patient being in quartile 4 of TLR-I regarding that cytokine) by the baseline concentration of TNF and IL-6. (C) Plot and Spearman’s correlation of proinflammatory cytokine concentrations at baseline and corresponding TLR-I effect; averaged via rank-sums over the proinflammatory immune mediators TNF, IL-6, IL-8, IL1α, IL1β. (D) Receiver operator characteristic for the prediction of a strong reaction to TLR-I ( i.e. , being within quartile 4 regarding the TLR-I effect) from the corresponding baseline cytokine concentrations; averaged via rank-sums over the five proinflammatory mediators TNF, IL-6, IL-8, IL-1α, β.

Figure Legend Snippet: Effects of triple TLR-blockade are correlated with and predicted by baseline IL-6 and TNF concentrations in host plasma. (A) Plot and Spearman’s rank correlations of baseline TNF and IL-6 concentrations in host plasma with the effect of triple toll-like receptor inhibition (TLR-I) on cytokine concentration changes over incubation ex vivo (expressed as difference in respective concentrations without and with triple inhibition by TLR2, 4, and endosomal TLRs). (B) Receiver operating characteristics (ROC), area under the curve (AUC), respective confidence intervals and p-values (regarding the null-hypothesis of AUC=0.5) of the prediction of a strong reaction to TLR-I ( i.e. , of a patient being in quartile 4 of TLR-I regarding that cytokine) by the baseline concentration of TNF and IL-6. (C) Plot and Spearman’s correlation of proinflammatory cytokine concentrations at baseline and corresponding TLR-I effect; averaged via rank-sums over the proinflammatory immune mediators TNF, IL-6, IL-8, IL1α, IL1β. (D) Receiver operator characteristic for the prediction of a strong reaction to TLR-I ( i.e. , being within quartile 4 regarding the TLR-I effect) from the corresponding baseline cytokine concentrations; averaged via rank-sums over the five proinflammatory mediators TNF, IL-6, IL-8, IL-1α, β.

Techniques Used: Inhibition, Concentration Assay, Incubation, Ex Vivo

Similar Products

anti tlr2 t2 5 antibody (Hycult Biotech)

Hycult Biotech anti tlr2 t2 5 antibody
Anti Tlr2 T2 5 Antibody, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti tlr2 t2 5 antibody/product/Hycult Biotech
Average 93 stars, based on 1 article reviews

anti tlr2 t2 5 antibody - by Bioz Stars, 2026-02

93/100 stars

Buy from Supplier

3h-labeled ligand 3-(((furan-2-yl-4,5-t2)methyl)amino)-5-(o-tolyl)-4h-benzo[e][1,2,4]thiadiazine 1,1-dioxide (Quotient Bioresearch)

Quotient Bioresearch 3h-labeled ligand 3-(((furan-2-yl-4,5-t2)methyl)amino)-5-(o-tolyl)-4h-benzo[e][1,2,4]thiadiazine 1,1-dioxide
3h Labeled Ligand 3 (((Furan 2 Yl 4,5 T2)Methyl)Amino) 5 (O Tolyl) 4h Benzo[E][1,2,4]Thiadiazine 1,1 Dioxide, supplied by Quotient Bioresearch, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3h-labeled ligand 3-(((furan-2-yl-4,5-t2)methyl)amino)-5-(o-tolyl)-4h-benzo[e][1,2,4]thiadiazine 1,1-dioxide/product/Quotient Bioresearch
Average 90 stars, based on 1 article reviews

3h-labeled ligand 3-(((furan-2-yl-4,5-t2)methyl)amino)-5-(o-tolyl)-4h-benzo[e][1,2,4]thiadiazine 1,1-dioxide - by Bioz Stars, 2026-02

90/100 stars

Buy from Supplier

sodium l-ascorbate (inchi = 1s/c6h8o6.na/c7-1-2(8)5-3(9)4(10)6(11)12-5;/h2,5,710h, 1h2;/q;+1/p-1/t2-,5+;/m0./s1) (Tokyo Chemical Industry)

Tokyo Chemical Industry sodium l-ascorbate (inchi = 1s/c6h8o6.na/c7-1-2(8)5-3(9)4(10)6(11)12-5;/h2,5,710h, 1h2;/q;+1/p-1/t2-,5+;/m0./s1)
Sodium L Ascorbate (Inchi = 1s/C6h8o6.Na/C7 1 2(8)5 3(9)4(10)6(11)12 5;/H2,5,710h, 1h2;/Q;+1/P 1/T2 ,5+;/M0./S1), supplied by Tokyo Chemical Industry, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sodium l-ascorbate (inchi = 1s/c6h8o6.na/c7-1-2(8)5-3(9)4(10)6(11)12-5;/h2,5,710h, 1h2;/q;+1/p-1/t2-,5+;/m0./s1)/product/Tokyo Chemical Industry
Average 90 stars, based on 1 article reviews

sodium l-ascorbate (inchi = 1s/c6h8o6.na/c7-1-2(8)5-3(9)4(10)6(11)12-5;/h2,5,710h, 1h2;/q;+1/p-1/t2-,5+;/m0./s1) - by Bioz Stars, 2026-02

90/100 stars

Buy from Supplier

sodium l-ascorbate (inchi = 1s/c6h8o6.na/ c7-1-2(8)5-3(9)4(10)6(11)12-5;/h2,5,7-10h, 1h2;/q;+1/p-1/t2-,5+;/m0./s1) (Tokyo Chemical Industry)

Tokyo Chemical Industry sodium l-ascorbate (inchi = 1s/c6h8o6.na/ c7-1-2(8)5-3(9)4(10)6(11)12-5;/h2,5,7-10h, 1h2;/q;+1/p-1/t2-,5+;/m0./s1)
Sodium L Ascorbate (Inchi = 1s/C6h8o6.Na/ C7 1 2(8)5 3(9)4(10)6(11)12 5;/H2,5,7 10h, 1h2;/Q;+1/P 1/T2 ,5+;/M0./S1), supplied by Tokyo Chemical Industry, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sodium l-ascorbate (inchi = 1s/c6h8o6.na/ c7-1-2(8)5-3(9)4(10)6(11)12-5;/h2,5,7-10h, 1h2;/q;+1/p-1/t2-,5+;/m0./s1)/product/Tokyo Chemical Industry
Average 90 stars, based on 1 article reviews

sodium l-ascorbate (inchi = 1s/c6h8o6.na/ c7-1-2(8)5-3(9)4(10)6(11)12-5;/h2,5,7-10h, 1h2;/q;+1/p-1/t2-,5+;/m0./s1) - by Bioz Stars, 2026-02

90/100 stars

Buy from Supplier

sgrna t2 reverse 5 aaacatcctgtccc tagtggcccc 3 (Danaher Inc)

Danaher Inc sgrna t2 reverse 5 aaacatcctgtccc tagtggcccc 3

Sgrna T2 Reverse 5 Aaacatcctgtccc Tagtggcccc 3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna t2 reverse 5 aaacatcctgtccc tagtggcccc 3/product/Danaher Inc
Average 86 stars, based on 1 article reviews

sgrna t2 reverse 5 aaacatcctgtccc tagtggcccc 3 - by Bioz Stars, 2026-02

86/100 stars

Buy from Supplier

sgrna t2 reverse 5 aaacatcctgtccctagtggcccc 3 (Danaher Inc)

Danaher Inc sgrna t2 reverse 5 aaacatcctgtccctagtggcccc 3

Sgrna T2 Reverse 5 Aaacatcctgtccctagtggcccc 3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna t2 reverse 5 aaacatcctgtccctagtggcccc 3/product/Danaher Inc
Average 86 stars, based on 1 article reviews

sgrna t2 reverse 5 aaacatcctgtccctagtggcccc 3 - by Bioz Stars, 2026-02

86/100 stars

Buy from Supplier

tlr2 (Hycult Biotech)

Hycult Biotech tlr2

Tlr2, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tlr2/product/Hycult Biotech
Average 93 stars, based on 1 article reviews

tlr2 - by Bioz Stars, 2026-02

93/100 stars

Buy from Supplier

anti tlr monoclonal antibodies mab t2 5 (InvivoGen)

InvivoGen anti tlr monoclonal antibodies mab t2 5

anti tlr monoclonal antibodies mab t2 5 - by Bioz Stars, 2026-02

86/100 stars

Buy from Supplier

Image Search Results

Journal: STAR Protocols

Article Title: Protocol for establishing inducible CRISPRd system for blocking transcription factor-binding sites in human pluripotent stem cells

doi: 10.1016/j.xpro.2024.103233

Figure Lengend Snippet:

Article Snippet: sgRNA_T2_Reverse: 5′-AAACATCCTGTCCC TAGTGGCCCC-3′ , IDT , N/A.

Techniques: Western Blot, Virus, Recombinant, Knock-Out, Membrane, Gentle, Infection, Protease Inhibitor, Gel Extraction, Plasmid Preparation, TaqMan Copy Number Assay, Lysis, Immunoprecipitation, SYBR Green Assay, Sequencing, Software

Journal: Frontiers in Immunology

Article Title: Substantial heterogeneity of inflammatory cytokine production and its inhibition by a triple cocktail of toll-like receptor blockers in early sepsis

doi: 10.3389/fimmu.2023.1277033

Figure Lengend Snippet: Effect of specific TLR2, 4, and 7/8 agonist stimulation or of bacterial immune stimulation with and without TLR blockade: dose finding studies for TLR blockade. Supernatant TNF and IL-6 concentrations measured by ELISA after 6 h of incubation of whole blood from healthy volunteers following stimulation with TLR2, 4, or 7/8 agonists or with heat-killed bacteria with and without antibodies directed against TLR2, TLR4, or with chloroquine. Concentrations as indicated. (A) Effects of the TLR2 agonist P 3 C. (B) Addition of anti-TLR2 mAb T2.5 30 min prior to the addition of the TLR2 agonist P 3 C (10 µg/ml). (C) Effects of the TLR4 agonist LPS : Re595. (D) Addition of anti-TLR4 mAb 3C3 30 min prior to addition of TLR4 agonist LPS : Re595 (0.1 µg/ml). (E) Effects of the endosomal inhibitor chloroquine (CQ) 30 min prior to the addition of TLR7/8 agonist Resiquimod (R848). (F) Addition of the endosomal inhibitor chloroquine (CQ) 30 min prior to addition of the TLR-independent immune stimuli phorbol-12-myristate-13-acetate and Ionomycin (PMA+I) as a toxicity control for CQ; low dose of PMA+I is 0.2 + 0.14 µg/ml, high dose is 1 + 0.7 µg/ml. (G) Addition of the endosomal inhibitor chloroquine (CQ) 30 min prior to the addition of heat-killed S. aureus or E . coli . n.d., not detected. Measurements from 2-3 individuals each. (A–F) single-point graph with means, (G) means with standard deviation.

Article Snippet: For TLR blockade we used the anti-TLR monoclonal antibodies (mAb) T2.5 ( , TLR2 antagonist; Invivogen, Toulouse, France) and 3C3 ( , TLR4 antagonist; Hycult Biotech, Uden, Netherlands), as well as the small molecule antimalarial and endosomal TLR-inhibitor chloroquine ( , Sigma-Aldrich, St. Louis, MO).

Techniques: Enzyme-linked Immunosorbent Assay, Incubation, Bacteria, Standard Deviation

Journal: Frontiers in Immunology

Article Title: Substantial heterogeneity of inflammatory cytokine production and its inhibition by a triple cocktail of toll-like receptor blockers in early sepsis

doi: 10.3389/fimmu.2023.1277033

Figure Lengend Snippet: Inhibition of supernatant inflammatory cytokine production by triple Toll-like receptor blockade upon bacterial stimulation in whole blood assays. Cytokine supernatant concentrations (ELISA) before and after incubation for 6 h of whole blood without or with heat-killed E. coli (10 5 cfu/ml; E.c.) or S. aureus bacteria (10 6 cfu/ml; S.a.) and without or with TLR blockade by 15 µg/ml monoclonal antibodies T2.5 and 3C3 directed against TLR2 (anti TLR2) and TLR4 (anti TLR4), or with 10 µg/ml chloroquine (CQ), or with a triple combination (TLR-I) when added 30 min prior to addition of bacterial stimuli. (A) Healthy volunteers (n=3). Single-point graph with means. Student’s t-test for paired samples. (B) Sepsis patients sampled within 24 h of sepsis diagnosis (n=10), multiplex (Luminex) ELISA. Tukey Boxplots. Wilcoxon matched pairs test. n.d., not detected. *one data point out of axis limits. Inc, Incubation for 6 h; Bac, added Bacteria. A combined blockade of TLR2, 4, and endosomal TLRs effectively suppresses bacteria-stimulated inflammatory cytokine production in whole blood assays both from healthy volunteers and sepsis patients.

Techniques: Inhibition, Enzyme-linked Immunosorbent Assay, Incubation, Bacteria, Multiplex Assay, Luminex

Journal: Frontiers in Immunology

Article Title: Substantial heterogeneity of inflammatory cytokine production and its inhibition by a triple cocktail of toll-like receptor blockers in early sepsis

doi: 10.3389/fimmu.2023.1277033

Figure Lengend Snippet: Robust TLR-dependent inflammation only in approximately a quarter of sepsis patients. (A) Supernatant inflammatory cytokine concentrations (multiplex ELISA) before and after a 6 h incubation (“Incubation”) of whole blood from sepsis patients (n=51, shaded columns) and healthy volunteers (n=11, open columns) with or without a triple combination of TLR inhibitors (“Triple TLR-I”; anti-TLR2 mAb T2.5, anti-TLR4 mAb 3C3 (both 15 µg/ml), chloroquine 10 µg/ml). Tukey boxplots. Mann-Whitney test for unpaired and Wilcoxon matched-pairs test for paired data sets. *one data point out of axis limits. (B) Patient samples sorted by their values for intrinsic ex vivo production of IL-6, TNF, IL-10, IL-1α or β over 6 hours (ΔIncubation). Shown are the quartile-medians of ΔIncubation and the paired TLR-I effect (sorted after ΔIncubation). Values from 51 sepsis patients sorted into 4 quartiles.

Techniques: Multiplex Assay, Enzyme-linked Immunosorbent Assay, Incubation, MANN-WHITNEY, Ex Vivo

Journal: Frontiers in Immunology

Article Title: Substantial heterogeneity of inflammatory cytokine production and its inhibition by a triple cocktail of toll-like receptor blockers in early sepsis

doi: 10.3389/fimmu.2023.1277033

Figure Lengend Snippet: The effect of a combined TLR-blockade is positively correlated with the intrinsic cytokine production ex vivo . (A) Supernatant inflammatory cytokine concentrations before and after a 6 h incubation of whole blood of sepsis patients (shaded columns) showing the greatest ex vivo production (ΔIncubation) of each cytokine after incubation for 6 h (quartile 4 of ΔIncubation) and of healthy volunteers (n=11, open columns) with or without a cocktail of TLR inhibitors (anti-TLR2 mAb T2.5, anti-TLR4 mAb 3C3 (both 15 µg/ml), and chloroquine 10 µg/ml). Data from quartile 4 (n=13 patients). Tukey boxplots. Mann-Whitney test for unpaired and Wilcoxon matched-pairs test for paired data sets. *one datapoint out of axis limits. (B) Plot and Spearman’s rank correlation of concentration changes over 6 hours of incubation (ΔIncubation) alone and with added TLR-inhibitors (TLR-I effect). n=51 patients. Negative values cannot be plotted on the logarithmic axes but are included in the analysis. Combined TLR-inhibition strongly inhibits cytokine production in those samples with a high intrinsic cytokine production. Intrinsic cytokine production and TLR-I effect correlate significantly.

Techniques: Ex Vivo, Incubation, MANN-WHITNEY, Concentration Assay, Inhibition

Journal: Frontiers in Immunology

Article Title: Substantial heterogeneity of inflammatory cytokine production and its inhibition by a triple cocktail of toll-like receptor blockers in early sepsis

doi: 10.3389/fimmu.2023.1277033

Figure Lengend Snippet: Effects of triple TLR-blockade are correlated with and predicted by baseline IL-6 and TNF concentrations in host plasma. (A) Plot and Spearman’s rank correlations of baseline TNF and IL-6 concentrations in host plasma with the effect of triple toll-like receptor inhibition (TLR-I) on cytokine concentration changes over incubation ex vivo (expressed as difference in respective concentrations without and with triple inhibition by TLR2, 4, and endosomal TLRs). (B) Receiver operating characteristics (ROC), area under the curve (AUC), respective confidence intervals and p-values (regarding the null-hypothesis of AUC=0.5) of the prediction of a strong reaction to TLR-I ( i.e. , of a patient being in quartile 4 of TLR-I regarding that cytokine) by the baseline concentration of TNF and IL-6. (C) Plot and Spearman’s correlation of proinflammatory cytokine concentrations at baseline and corresponding TLR-I effect; averaged via rank-sums over the proinflammatory immune mediators TNF, IL-6, IL-8, IL1α, IL1β. (D) Receiver operator characteristic for the prediction of a strong reaction to TLR-I ( i.e. , being within quartile 4 regarding the TLR-I effect) from the corresponding baseline cytokine concentrations; averaged via rank-sums over the five proinflammatory mediators TNF, IL-6, IL-8, IL-1α, β.

Techniques: Inhibition, Concentration Assay, Incubation, Ex Vivo